Introduction

Aloe vera (Aloe barbadensis Miller) belongs to the Asphodelaceae (Liliaceae) family. This plant contains triangular and fleshy green leaves. The color of its flower is yellow and its fruits contain many seeds (Surjushe et al. 2008). The plants grow well in tropical, sub-tropical, and arid climates, including the desert, grassland and coastal areas. In particular, Aloe vera is cultivated mostly in the areas of sub-Saharan Africa, Saudi Arabian Peninsula and Western Indian Ocean (Reynolds and Dweck 1999). Its plants are mainly utilized for gel-production which has several uses in agriculture, food and medicine. Aloe vera plants have several medicinal properties like anti-cancer, anti-oxidant, anti-inflammatory and anti-bacteria effects, and is also used to treat wounds, burns and diabetes (Akinsanya et al. 2015).

A number of infections that lead to devastating diseases in Aloe vera have been identified. Some important pathogens have been identified as Erwinia chrysanthemi (Pectobacterium chrysanthemi) which causes the bacterial soft rot disease ( Laat et al. 1994; Mandal and Maiti 2005) and Fusarium spp. that causes leaf rot/base rot diseases (Ayodele and Ilondu 2008) in Aloe vera. The symptoms caused by these pathogens become more serious in conditions of abundant moisture during irrigation or rainy season. The diseases caused by these pathogens lead to reduced quality and quantity of the produce.

In recent years, the bacterium, E. cloacae has been reported as an important pathogen that can cause diseases in different plant species. The infection of E. cloacae has been reported in several fruits, for example, in papaya fruits this bacterium causes typical symptoms around the blossom end and symptoms like soft, yellow discoloration, and offensive odor in infected fruits (Nishijima 1987); Similarly, it causes symptoms in the onions with yellow to brown discoloration, bulbs and loss of turgor (Bishop 1990; Schroeder et al. 2010) and in the Odontioda orchids symptoms like the water-soaked lesions, light to dark brown discoloration, and necrosis (Takahashi et al. 1997); In ginger plant, E. cloacae caused symptoms like yellowish-brown to brown discoloration and firm to spongy texture (Nishijima et al. 2004); however, in case of Macadamia spp. development of gray discoloration and foul odor are important symptoms caused by this bacterium (Nishijima et al. 2007); Likewise, in the dragon fruit, yellowish to brownish discoloration, soft rot in fruit and stem appears (Masyahit et al. 2009); while in mulberry (Morus alba), browning of vascular tissues, leaf wilt, and defoliation is caused by E. cloacae (Wang et al. 2010); Moreover, in cassava, chlorotic halo , senescence of leaves, and stem bare (Santana et al. 2012); in lucerne, yellowing, rot and sprout decay (Zhang and Nan 2013) and in chili pepper, brown necrosis at margins of leaf tips and defoliation (García-González et al. 2018). However, to the date, there has been no scientific report of E. cloacae infection in Aloe vera.

Vietnam is a tropical country that is locates on the eastern margin of the Indo-Chinese Peninsula. Aloe vera was the first introduced in the country in 2002. This plant has been growing mostly in Ninh Thuan province, a south-central coastal region with a typical arid climate and sandy soil conditions. Since 2011, a severe soft rot disease on the Aloe vera plants has frequently occurred during the wet period. This disease leads to serious economic losses due to plant deaths. The aim of this study was to isolate, characterize and identify the pathogenic bacterium and study on the disease occurrence and pathogenicity of the bacterial soft rot disease outbreak on Aloe vera plants in Vietnam.

Materials and Methods

Sample collection

Samples of the suspected bacterial soft rot Aloe vera plants were collected from the Aloe vera fields in Ninh Thuan province, a south-central coast region of Vietnam, during February and August 2019. The observed symptoms were water -soaked lesions, gas formation, rotting, yellow discoloration and collapsing at the base of the leaves. All the samples were stored in a cool box and immediately transported to the laboratory within 24 h for bacteria isolation.

Bacterial isolation and biochemical characteristics

Briefly, the leaf samples were surface sterilized with 70% alcohol for 3–5 min and rinsed twice with sterile distilled water (SDW) and dried for 15 min. A piece of 3 mg of the symptomatic tissues of the leaf sample was collected and suspended in 1 mL of SDW. After that, a 100 µL of each 10-times serial dilution was spread onto nutrient agar (NA) plates (Sigma-Aldrich, St. Louis, MO) in triplicate. The plates were incubated at 30°C for at least 24–48 h or until colony formation was observed. The single colonies were picked from the isolation plates for further analyses. For biochemical characterization of the isolated bacteria, 20E API kit (BioMerieux Inc., Durham, NC, USA) was used.

Pathogenicity test and re-isolation of the pathological bacteria

The single colonies were passaged on NA and incubated at 30°C for 48 h. The selected bacteria were re-suspended in SDW and adjusted to an optical density of 0.1 at A₆₀₀ (an approximately titer of 10⁸ colony forming units (cfu) per mL). Plants were grown in greenhouse for at least three months for pathological test. Briefly, 0.1 mL (about 10⁷ cfu) of inoculum was injected to the base of each Aloe vera plant by a syringe and hypodermic needle. The SDW-injected Aloe vera plant was used as control. The injected plants were grown in the greenhouse and the symptoms were observed at 12–24 h. The pathological bacteria in each test were re-isolated.

Total DNA extraction and Polymerase Chain Reaction (PCR)

Bacteria DNA was extracted using the QIAamp DNA Mini Kit (Qiagen , Valencia, CA, USA ), according to the manufacturer’s instructions. Extracted DNA was resuspended in RNase-free water and stored at -80°C until PCR analysis was performed. The 16S rRNA gene was amplified from the bacterial genome using the 27F/1492R primer set (27F: 5’-AGAGTTTGATCMTGGCTCAG-3’; 1492R: 5’-GGTTACCTTGTTACGACTT-3’) as previously described (Turner et al. 1999; Gloeckner et al. 2013). In addition, for further analysis of the E. cloacae, a multi-locus sequence strategy was done by using three housekeeping genes, including the hsp60, fusA and leuS, following the previous description (Hoffmann and Roggenkamp 2003; Miyoshi-Akiyama et al. 2013). The sequences of all the primers used in this study are given in Table 1. The PCR reaction was carried out at 95°C for 5 min (pre-denaturation), 35 cycles of 95°C for 1 min (for denaturation), 52 to 62°C for 30 s to 1 min (for annealing) and 72°C for 1 min (for extension), followed by 72°C for 10 min (for final extension). Table 1: List of primers used for ampliﬁcation and sequencing of the Enterobacter cloacae isolates in this study

Gene	Primer name	Primer Sequence (5’-3’)	Position	Reference
16S	27F	AGAGTTTGATCMTGGCTCAG	+	(Lane et al. 1991; Turner et al. 1999)
16S	1492R	GGTTACCTTGTTACGACTT	-	(Lane et al. 1991; Turner et al. 1999)
Hsp60	Hsp60-F	GGTAGAAGAAGGCGTGGTTGC	+	(Hoffmann and Roggenkamp. 2003)
Hsp60	Hsp60-R	ATGCATTCGGTGGTGATCATCAG	-	(Hoffmann and Roggenkamp. 2003)
fusA	fusA-f2	TCGCGTTCGTTAACAAAATGGACCGTAT	413–440, +	(Miyoshi-Akiyama et al. 2013)
fusA	fusA-r2	TCGCCAGACGGCCCAGAGCCAGACCCAT	1291–1318, -
leuS	leuS-f2	GATCARCTSCCGGTKATCCTGCCGGAAG	1342–1369, +
leuS	leuS-r	ATAGCCGCAATTGCGGTATTGAAGGTCT	2159–2186, -

The size of PCR products was then studied by running it on 1.2% SeaKem LE agarose gel and the resultant bands were viewed on a BioRad Gel Doc XR image-analysis system.

Nucleotide sequencing and sequence analysis

The amplified PCR products were purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. For 16S rRNA gene, the amplified genes were inserted into a pCR 2.1 cloning vector and transformed into E. coli TOP10F (Gibco Invitrogen, Foster City, CA, USA) and the M13 reverse and T7 promoter primers were used for sequencing. For the remaining genes, including hsp60, fusA and leuS, the PCR primer sets were used for direct sequencing. All the amplified genes were sequenced by using a BigDye terminator cycle sequencing kit and an automatic DNA sequencer (Model 3730, Applied Biosystems, Foster City, CA, USA) at Macrogen Institute (Macrogen Co., Ltd.). The raw sequences were assembled by the SeqMan program (DNAstar package, Madison, WI). The complete sequences were aligned using BioEdit v. 7.2.5 (Yang et al. 2017). The resultant nucleotide sequences were aligned using the ClustalX 2.1 program (Larkin et al. 2007) and Lasergene software (DNASTAR; Madison, WI, USA) by using the parameters set against the corresponding E. cloacae sequences from the NCBI GenBank.

Phylogenetic analysis

The nucleotide sequences of the 16S rRNA, hsp60, fusA, and leuS genes from the isolated E. cloacae strain in this study were compared against representative gene sequences from the available E. cloacae sequences in the GenBank database. Multiple sequence alignments of the 16S rRNA gene sequence of the selected strains (NiT01/2019, NiT02/2019 and NiT03/2019) with the corresponding sequences from a broad selection of closely related strains, and calculations of the levels of sequence similarity, were made using the open DNA BLAST server (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and CLUSTAL X 2.1 software (Larkin et al. 2007). Evolutionary distance matrices were generated by the neighbour-joining method described by Jukes and Cantor (1969). Phylogenetic tree was constructed by the MEGA 6.06 software package using the neighbour-joining method (Saitou and Nei 1987) and branch support in neighbour-joining tree was estimated by bootstrap resampling method with 1000 replicates (Felsenstein 1985).

Results

Infected symptoms of the Aloe vera

The bacteria soft rot disease symptoms of Aloe vera in Ninh Thuan province usually occurred after heavy rainfall and/or in the rainy season. These early conditions mainly cause the water-soaked lesions on the plant leaves followed by the infection of bacteria. Therefore, the symptoms were observed around the middle and the blossom end of the leaves. Specifically, the infection started at the water-soaked lesions and then quickly spread rounding of the leaves, leading to yellow discoloration, gas formation, rotting, and collapsing at the base of leaves (Fig. 1).

Bacterial isolation, morphology and biochemical characterization

Three strains of pathogenic agent were isolated from the typical yellow discolored lesions of the plant leaves by using NA media. The isolated strains displayed only one type of bacterial colony, including characteristics of creamy white color, opaque, mucoid, circular, and convex. The isolated strains were Gram negative, rod-shape, about 0.64 μm wide and 1.08 μm long and with peritrichous flagella (Fig. 2). The optimal growth temperature for these isolated strains is 35–37°C. The API 20E kit was used to biochemical characterization of strain NiT01/2019 and the results are shown in Table 2. Strain NiT01/2019 can produce β-galactosidase and Arginine dehydrolase enzymes and can utilize citrate. This strain used mannitol,

Fig. 1: Symptoms produced by E. cloacae on Aloe vera in the field. (A) Mass of infected Aloe vera was culled. (B) The typical soft rot disease symptom of the infected Aloe vera with E. cloacae

Fig. 2: Electron micrographs of the E. cloacae strain NiT01/2019 showing rod-shaped cells and peritrichous flagella. Black bar (nm, left panel; and μm, right panel)

D-Sorbitol, D-Sucrose, D-Melibiose, Amygdalin and L-Arabinose as substrate to produce acids.

Table 2: Physiological and biochemical characteristics of the Enterobacter cloacae strains

Characteristic	NiT/2019	ATCC 13047^*	E. cloacae^**
Gram staining	-	-	-
Rod shaped cell morphology	+	+	+
Enzymatic activities:
β galactosidase	+	+	+
Arginine dehydrolase	+	+	+
Lysine decarboxylase	-	-	-
Ornithine decarboxylase	+	+	+
Citrate utilization	+	+	+
Hydrogen sulfide	-	-	-
Urease	-	-	-
Tryptophan deaminase	-	-	-
Indol	-	-	-
Voges-Proskauer	+	+	+
Gelatin liquefaction	-	-	-
Acid production from:
D-Glucose	-	+	+
Mannitol	+	+	+
Inositol	-	-	-
D-Sorbitol	+	+	+
L-Rhamnose	+	+	three (+), one (-)
D-Sucrose	+	+	+
D-Melibiose	+	+	+
Amygdalin	+	+	+
L-Arabinose	+	+	+

Reference strains used: ^*E. cloacae ATCC 13047 from Bergey’s manual (Bergey and Holt 1994) and ^**E. cloacae isolated from cassava (Santana et al. 2012)

Molecular identification of isolated bacteria

All the obtained nucleotide sequences of the strains under study were deposited in GenBank database under the accession numbers from MT779005 to MT779016. The partial sequence of the 16S rRNA genes of the three isolated strains, the NiT01/2019, NiT02/2019 and NiT03/2019 were amplified and the sequencing was done followed by comparison with the representative sequences which were available on Genbank database. The partial sequence of the 16S rRNA of the three isolated strains was 1500 bp in length. The nucleotide sequence of 16S rRNA gene of the three isolated strains shared 100% sequence similarity. In addition, the nucleotide sequences of the 16S rRNA of the three isolated strains shared the similarity of 97.3–98.0% to the sequence of E. cloacae strains available in the Genbank database, i.e., E. cloacae A5 strain (accession MN826713), E. cloacae ATCC-13047 strain (accession CP001918), E. cloacae R6354 strain (JQ659813), E. cloacae R6355 strain (accession JQ659814), and E. cloacae 3YN16 strain (accession GU549440). Phylogenetic analysis indicated that the isolated strains were clustered into the E. cloacae group (Fig. 3). Base on this nucleotide sequence, the 16S rRNA sequences of the three isolated bacteria strains in this study were identified as the members of Enterobacteriaceae family (Hauben et al. 1998).

In addition to 16S rRNA gene, three more housekeeping genes (hsp60, fusA, and leuS) were amplified and sequenced to further verify the isolated strains within the available E. cloacae complex. The nucleotide sequences of the hsp60, fusA and leuS genes of the three studied strains shared > 98.5%, > 99.1% and > 99.0% sequence similarity, respectively, with the available sequences of the hsp60, fusA and leuS genes of the E. cloacae in Genbank database. These isolates included E. cloacae the ATCC-13047 strain (accession CP001918), E. cloacae CBG15936 strain (accession CP046116), E. cloacae M12X01451 strain (accession CP017475), Effluent-2, -3, -4 E. cloacae strains (accession CP039318, CP039311, CP039303, respectively), E. cloacae PIMB10EC27 strain (accession CP020089), E. cloacae SBP-8 strain (accession CP016906), E. cloacae GGT036 strain (accession CP009756) and E. cloacae NH77 strain (accession CP040827). Phylogenetic analysis based on the DNA sequence of hsp60 gene grouped our three isolated strains into the XI cluster within the E. cloacae strains (Hoffmann and Roggenkamp 2003), along with the E. cloacae ATCC-13047 strain (accession EU643113), E. cloacae EN-475 strain (accession AJ543855), and E. cloacae EN-287 strain (accession AJ543768) (Fig. 4).

Pathogenicity test

The NiT01/2019, NiT02/2019 and NiT03/2019 strains were found pathogenic to all healthy Aloe vera after 24 h post-inoculation. The symptoms of the Aloe vera in pathogenicity test were observed similarly to those appears on the plants observed in the field during sample collection. The symptoms start to appear at the injection sites and grew very fast leading to yellow discoloration with gas formation and the leaves became rotted and finally collapsed after 4-days post-inoculation (Fig. 5). The same bacteria strains were re-isolated and characterized. In contrast, the control group of Aloe vera did not show any symptoms.

Discussion

In this study, we report a new disease on Aloe vera in Ninh Thuan province, Vietnam caused by E. cloacae. Morphological, biochemical, molecular analysis and sequencing of housekeeping genes; hsp60, fusA and leuS demonstrated accurate identification of all the three isolated strains as E. cloacae (Hoffmann and Roggenkamp 2003).

Fig. 3: Phylogenetic tree based on the 16S RNA gene sequences of the three E. cloacae strains (NiT01/2019, NiT02/2019, and NiT03/2019) in this study and other known E. cloacae strains from the GenBank database. Numbers at the nodes indicate the level of bootstrap support (%) based on neighbor-joining analysis of 1,000 re-sampled datasets. Only values greater than 70% are provided. The bar represents 0.005 substitutions per nucleotide position. The three strains in this study are marked in italic and bold

E. cloacae bacteria from the genus Enterobacter are able to adapt, survive and proliferate in diverse environmental conditions (Sanders and Sanders 1997). In addition to infecting plant species, E. cloacae is also well-known as the most important pathogen of human health globally and has been found associated with up to 10% of postsurgical peritonitis cases, 5% of hospital-acquired sepsis, 5% of nosocomial pneumonias, and 4% of nosocomial urinary tract infections (Hoffmann and Roggenkamp 2003). Moreover, it has been reported as a causal agent of many kinds of plant diseases, for example, causes different diseases with diverse symptoms in papaya (Nishijima 1987), onion (Bishop 1990), orchids (Takahashi et al. 1997), ginger (Nishijima et al. 2004), macadamia (Nishijima et al. 2007), dragon fruit (Masyahit et al. 2009), mulberry (Wang et al. 2010), cassava (Santana et al. 2012), lucerne (Zhang and Nan 2013) and chili pepper (García-González et al. 2018). Interestingly, this study has identified E. cloacae for the first time as a new pathogenic bacterium causing soft rot disease outbreaks of Aloe vera in Vietnam.

There are the several ways through which the pathogenic bacteria may acquire plant-pathogenic potential. Deposition of animal pathogens back to environment like give these pathogens a chance to stay near or onto plants where they could easily exchange of the genetic information with other organisms in the environment (Kirzinger et al. 2011). For instance, in human, diarrhea disease that is primarily caused by an infection of bacteria can escape from the host into the environment (Müller 1986). This bacterial cells can move from the human wastes to natural source of irrigation water which increases the accumulation of bacterial cell communities into the above-ground portions of the plants (Cooley et al. 2003; Schikora et al. 2008). However, bacteria also infect plants through indirect routes where insects function as transports from the human host to the general environment and likely to the plants (Nadarasah and Stavrinides 2011).

In this study, Aloe vera plants were observed with the water-soaked lesions, dark to yellow discoloration and quick rotting with gas formation, and ultimately collapsing at the base of leaves. The disease causes the dramatic economic losses

Fig. 4: Phylogenetic tree based on the hsp60 gene sequences of the three E. cloacae strains (NiT01/2019, NiT02/2019, and NiT03/2019) in this study and other known E. cloacae strains from the GenBank database. Numbers at the nodes indicate the level of bootstrap support (%) based on neighbor-joining analysis of 1,000 re-sampled datasets. Only values greater than 70% are provided. The bar represents 0.005 substitutions per nucleotide position. The three strains in this study are marked in italic and bold

suffered by the death or culling of the infected plant. However, the pathogen has not been well identified and therefore the culling or isolating methods are used to prevent spread of the disease. Therefore, more research and experiment are needed to find out the information of epidemiology of this disease in Aloe vera plants which could lead to a management plan to reduce its invasion.

Conclusion

This is the first report of the E. cloacae that has been identified as a new pathogenic bacterium causing soft rot disease outbreaks of Aloe vera in Vietnam. These findings provide the important information regarding the epidemiology, physiology, pathology and genetic diversity of the bacterium and its associated strains. The further analysis will important in study of the origin, pathogenesis and establishment of essential management systems of this particular disease in E. cloacae.

Acknowledgements

This research was funded by the Department of Science and Technology, Ninh Thuan province (Project number: 05/2019/HĐ-SKHCN).

Fig. 5: Pathogenicity test in the healthy Aloe vera in greenhouse (A) The SDW-injected Aloe vera plant was used as control. (B) and (C) The E. cloacae-injected Aloe vera plants after one and two days of post-injection, respectively. (D) The E. cloacae-injected Aloe vera plant after four days of post-injection with the typical symptoms of soft rot and gas formation

Author Contributions

TNN, VTT conceived and designed the proposal, and funding acquisition. TNN, TVN, TCNH, HPTN performed the experiments. TNN, HMN, VPL, MK, VTT participated in analyzing the data. TNN, HMN, MK, VTT wrote and revised the manuscript. All authors have read and approved the final manuscript.

Conflict of Interest

The authors declare that they have no conflict of interest.

Data Availability

Data presented in this study are available with the authors

Ethics Approval

There are no researches conducted on animals or humans.

References

Akinsanya MA, JK Goh, SP Lim, ASY Ting (2015). Diversity, antimicrobial and antioxidant activities of culturable bacterial endophyte communities in Aloe vera. FEMS Microbiol Lett 362:1–8

Ayodele SM, EM Ilondu (2008). Fungi associated with base rot disease of aloe vera (Aloe barbadensis). Afr J Biotechnol 7:4471–4474

Bishop AL (1990). Internal Decay of Onions Caused by Enterobacter cloacae. Plant Dis 4:692‒694

Cooley MB, WG Miller, RE Mandrell (2003). Colonization of Arabidopsis thaliana with Salmonella enterica and enterohemorrhagic Escherichia coli O157: H7 and competition by Enterobacter asburiae. Appl Environ Microbiol 69:4915‒4926

Felsenstein J (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783‒791

García-González T, HK Sáenz-Hidalgo, HV Silva-Rojas, C Morales-Nieto, T Vancheva, R Koebnik, GD Ávila-Quezada (2018). Enterobacter cloacae, an emerging plant-pathogenic bacterium affecting chili pepper seedlings. Plant Pathol J 34:1‒10

Gloeckner V, U Hentschel, AV Ereskovsky, S Schmitt (2013). Unique and species-specific microbial communities in Oscarella lobularis and other Mediterranean Oscarella species (Porifera: Homoscleromorpha). Mar Biol 160:781‒791

Hauben L, ERB Moore, L Vauterin, M Steenackers, J Mergaert, L Verdonck, J Swings (1998). Phylogenetic position of phytopathogens within the Enterobacteriaceae. Syst Appl Microbiol 21:384‒397

Hoffmann H, A Roggenkamp (2003). Population genetics of the nomenspecies Enterobacter cloacae. Appl Environ Microbiol 69:5306‒5318

Bergey, D.H. and Holt, J.G. (1994) Bergey’s Manual of Determinative Bacteriology. 9^th ed. Williams & Wilkins, Baltimore, Maryland, USA

Jukes TH, CR Cantor (1969). Evolution of protein molecules. In: Mammalian Protein Metabolism, Vol. 3, pp:21–132. Academic Press, New York, USA

Kirzinger MW, G Nadarasah, J Stavrinides (2011). Insights into cross-kingdom plant pathogenic bacteria. Genes 2:980‒997

Laat PCAD, JTW Verhoeven, JD Janse (1994). Bacterial leaf rot of Aloe vera L., caused by Erwinia chrysanthemi biovar 3. Eur J Plant Pathol 100:81‒84

Lane DJ (1991). 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics, pp:115‒175. Stackebrandt E, M Goodfellow (Eds). John Wiley & Sons, Inc, New York, USA

Larkin MA, G Blackshields, NP Brown, R Chenna, PA Mcgettigan, H McWilliam, F Valentin, IM Wallace, A Wilm, R Lopez, JD Thompson, TJ Gibson, DG Higgins (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23:2947‒2948

Mandal K, S Maiti (2005). Bacterial soft rot of aloe caused by Pectobacterium chrysanthemi: A new report from India. Plant Pathol 54:573

Masyahit M, K Sijam, Y Awang, MGM Satar (2009). First report on bacterial soft rot disease on dragon fruit (Hylocereus spp.) caused by Enterobacter cloacae in Peninsular Malaysia. Intl J Agric Biol 11:659–666

Miyoshi-Akiyama T, K Hayakawa, N Ohmagari, M Shimojima, T Kirikae (2013). Multilocus Sequence Typing (MLST) for characterization of Enterobacter cloacae. PLoS One 8; Article e66358

Müller H (1986). Occurrence and pathogenic role of Morganella-Proteus-Providencia group bacteria in human feces. J Clin Microbiol 23:404‒405

Nadarasah G, J Stavrinides (2011). Insects as alternative hosts for phytopathogenic bacteria. FEMS Microbiol Rev 35:555‒575

Nishijima KA (1987). Internal yellowing, a bacterial disease of papaya fruits caused by Enterobacter cloacae. Plant Dis 92:483–488

Nishijima KA, MM Wall, MS Siderhurst (2007). Demonstrating pathogenicity of Enterobacter cloacae on macadamia and identifying associated volatiles of gray kernel of macadamia in Hawaii. Plant Dis 91:1221‒1228

Nishijima KA, AM Alvarez, PR Hepperly, MH Shintaku, LM Keith, DM Sato, BC Bushe, JW Armstrong, FT Zee (2004). Association of Enterobacter cloacae with rhizome rot of edible ginger in Hawaii. Plant Dis 88:1318‒1327

Reynolds T, AC Dweck (1999). Aloe vera leaf gel: A review update. J Ethnopharmacol 68:3‒37

Saitou N, M Nei (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406‒425

Sanders W, CC Sanders (1997). Enterobacter spp.: Pathogens poised to flourish at the turn of the century. Clin Microbiol Rev 10:220‒241

Santana MA, M Rodriguez, J Matehus, J Faks, A Bocsanczy, A Gerstl, G Romay, J Montilla, CE Fernánde, NM Zambrano, D Marval (2012) . A new bacterial disease of cassava in venezuela caused by Enterobacter cloacae. Intl J Agric Biol 14:183‒189

Schikora A, A Carreri, E Charpentier, H Hirt (2008). The dark side of the salad: Salmonella typhimurium overcomes the innate immune response of Arabidopsis thaliana and shows an endopathogenic lifestyle. PLoS One 3; Article e2279

Schroeder BK, TD Waters, LJ Du-Toit (2010). Evaluation of onion cultivars for resistance to Enterobacter cloacae in storage. Plant Dis 94:236‒243

Surjushe A, R Vasani, D Saple (2008). Aloe vera: A short review. Ind J Dermatol 53:163–166

Takahashi Y, K Takahashi, M Sato, K Watanabe, T Kawano (1997). Bacterial leaf rot of Odontioda Orchids caused by Enterobacter cloacae. Ann Phytopathol Soc Jpn 63:164‒169

Turner S, KM Pryer, VPW Miao, JD Palmer (1999). Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J Eukaryot Microbiol 46:327‒338

Wang GF, GL Xie, B Zhu, JS Huang, B Liu, P Kawicha (2010). Identification and characterization of the Enterobacter complex causing mulberry (Morus alba) wilt disease in China. Eur J Plant Pathol 126:465‒478

Yang H, H Zou, M Chen, S Li, J Jin, J Ma (2017). The green synthesis of ultrafine palladium–phosphorus alloyed nanoparticles anchored on polydopamine functionalized graphene used as an excellent electrocatalyst for ethanol oxidation. Inorg Chem Front 4:1881‒1887

Zhang Z, Z Nan (2013). Occurrence of lucerne seed-borne Enterobacter cloacae sprout decay in Gansu province of China. Eur J Plant Pathol 135:5‒9